- Original Research
- Open access
- Published:
Genetic and other epidemiological risk factors of infants and children with hypospadias: a case control study
African Journal of Urology volume 29, Article number: 55 (2023)
Abstract
Background
To study hypospadias as regard epidemiological risk factors and genetic association with mutations in Steroid 5 alpha reductase type 2 genes.
Materials
This study was conducted on two groups; the first group included 50 male children with hypospadias and the other group included 50 male healthy children as a matched control. All patients and controls were subjected to detailed history, physical examination and molecular study of 5-alpha-reductase gene polymorphisms (V89L and G34R).
Results
Mean age in hypospadias group was 3.28 ± 2.87 years. The most common type of hypospadias was the glanular type in 19 children (38%). Higher maternal and paternal age, consanguinity, rural residence and preterm labor carry significant epidemiological risk factors for hypospadias. According to genetic study, all healthy children carried the wild valine residue (VV) genotype, while only 44% of hypospadias cases carried the wild VV genotype and 56% carried the mutant L allele (homozygote for leucine residue and heterozygote for both valine and leucine (VL)) with high significant p value (p < 0.001). For Allele Specific—polymerase chain reaction for glycine to arginine (G34R) mutation detection in the 5 alpha reductase type 2 gene, hypospadias children had significantly higher frequency of heterozygous GR genotype than healthy controls. Binary logistic regression analysis showed that mother age and rural residence were the most independent predictors for hypospadias.
Conclusions
V89L and G34R Steroid 5 alpha reductase type 2 gene polymorphisms, higher maternal and paternal age, consanguinity, rural residence and preterm labor carry significant risk factors for hypospadias. On multivariate logistic regression, mother age and rural residence are the most independent predictors for hypospadias.
1 Background
Hypospadias is a congenital anomaly in which the urethral opening is not rightly positioned at the tip of the penis as a result of incomplete fusion of urethral folds [1]. Its prevalence varies significantly across different countries ranging from one in 125–250 male live births [2]. It may be syndromic or non-syndromic with an unknown etiology with a supposed mix of monogenic and/or multifactorial forms, including both genes [3] and environmental (e.g., antiepileptic drugs [4], maternal hypertension [5], or preexisting diabetes [6]).
Androgens are essential for the formation of the male urogenital system. Any defect in the androgen synthesis (androgen deficiency) or in androgen receptor (AR) may play a causative role in the development of hypospadias [7]. The development of male reproductive tissue, involving the urethra, normally requires testosterone and dihydrotestosterone (DHT) [8]. Testosterone is transformed to the more potent androgen, DHT, by an enzyme known as steroid 5α-reductase type 2 (SRD5A2) which is encoded by the SRD5A2 gene that is located on chromosome 2p23 [9]. Several mutations have been found that may be implicated in hypospadias [10]. So, our work aimed to study hypospadias as regard epidemiological risk factors and genetic association with mutations in Steroid 5 alpha reductase type 2 (SRD5A2) genes.
2 Methods
The present prospective case–control study was carried out in the period from June 2021 to July 2022 after obtaining an informed written consent from all enrolled children family prior to the study. The protocol followed the ethical considerations proposed by our Faculty of Medicine Ethical Committee (IRB approval number 7/2020PED114).
This study was conducted on two groups; the first group included 50 male children with hypospadias and the other group included 50 male healthy children as a matched control who attended to our pediatric unit outpatient clinics. We included children less than 12 years while we excluded children suffering from known genetic or chromosomal abnormalities, children with dysmorphic features and/or multiple congenital anomalies suggestive of genetic syndrome or chromosomal disorder and finally children with parental consent refusal. All patients and controls were subjected to detailed history (demographic data, Pedigree and family history, antenatal history and past history including medical and surgical history), physical examination (thorough clinical examination of all body systems, clinical examination of external genitalia and anthropometric measurements). Scrotal and abdominal ultrasound was undertaken in those with posterior hypospadias to exclude any abnormality. Serum total testosterone level and molecular study of 5-alpha-reductase gene polymorphisms (V89L rs523349 and G34R rs782032018) was carried out before hypospadias correction at our genetic laboratory. According to the standard nomenclature recommendations of the HGVS (http://www.HGVS.org/mutnomen/), genetic variants can be expressed at the level of DNA sequence change or the amino acid change. So, according to NCBI-CLINIVAR, SRD5A2 gene polymorphisms (rs523349 and rs782032018) are expressed as V89L and G34R, respectively, where V89L refers to substitution of valine by leucine and G34R refers to substitution of glycine by arginine. Deoxyribonucleic acid (DNA) was extracted from 2 ml venous blood sample by DNA extraction kit (Gene JET Whole Blood Genomic DNA Purification Mini Kit) according to the manufacturer’s instructions. The extracted DNA stored at -20°C.
2.1 PCR- RFLP V89L_SRD5A2 gene
The polymerase chain reaction (PCR) to amplify genomic DNA was performed with the use of forward primer 5′-CGCCTGGTTCCTGCAGGAGCT-3’and reverse primer 5’GTGAAGGCGGCGTCTGTG-3′. The primer sequences were examined for cross homology with repetitive sequences or with other loci somewhere else in the genome using Basic Local Alignment Search Tool (BLAST). The products were then digested with 5 unites of RsaI (Thermo Fisher Scientific Inc. http://www.thermoscientific.com/fermentas) [11].
2.2 Allele-specific polymerase chain reaction (AS-PCR) for G34R mutation detection
The principle of AS-PCR is based on the formation of matched or mismatched primer-target complexes [12]. Two forward primers, i.e., wi-34-f and mut-34-2f for wild and mutated alleles, respectively, as well as two reverse primers, 34-r and 34-2r were used. Primer sequences were: (Wi-34f) 5_AAGCCCTCCGGCTACG3, (Mut-34f) 5_AAGCCCTCCGGCTACA3, (34r) 5_GGAAAAACGCTACCTGTGGA3_, (342r) 5_CAAGGGAAAAACGCTACCTG3_ [13].
During family counseling, we discussed the clinical aspects, the diagnostic approach and the importance of the genetic study with the family. We reassured patient family, especially about future reproductive function of their children and structured follow-up visits. All hypospadias cases in our study had surgical correction.
2.3 Statistical analysis
Results were statistically analyzed by statistical package SPSS version 20. Two types of statistics were done. Descriptive: e.g. percentage (%), median, mean and standard deviation (SD) and analytical by Mann–Whitney test (a nonparametric test of Student's t-test used to indicate the presence of any significant difference between two groups for a not normally distributed quantitative variable), Chi-Squared (χ2) test (used to compare between two groups or more regarding one qualitative variable), Fisher's exact test (it is a statistical significance test used in the analysis of contingency tables). It is employed when sample sizes are small. Sample was calculated by the following equation {n = P1 (1 − P1) + P2(1 − P2)/(P1 − P2)2 * C} where, n = desired sample size, P1, 2:Proportion in each group and C:standard value α and β its equal to 7.85 at power 80% and confidence level 95%. The calculated total sample after adding dropout 10%, was 72 participants. Due to availability of cases during our practical part of the study, sample was increased to 100 participants who were allocated into two groups. Logistic regression was used, and odds ratio (OR) and confidence interval (CI) were determined for detection of potential predictive factors for hypospadias. The coefficient interval was set to 95%. The level of significance was calculated according to the following probability (p) values: p < 0.05 was considered statistically significant, p < 0.001 was highly significant and p > 0.05 was considered statistically non-significant.
3 Results
In our study, hypospadias children were matched well with the control group as regards age and delivery method. Mean age in hypospadias group was 3.28 ± 2.87 years. Regarding distribution of type of hypospadias among our cases, the most common type of hypospadias was the glanular type in 19 children (38%), coronal in 10 (20%), subcoronal in 7 (14%) and penoscrotal in 9 children (18%) and lastly midshaft in 5 (10%). Chordee was found in penoscrotal cases. All cases had bilateral normal scrotal testes. Stretched penile length was measured by plastic tape measure with no cases had micropenis. After detailed history, we found higher maternal and paternal age, consanguinity; rural residence and preterm labor carry significant risk factors for hypospadias (Table 1).
According to genetic study, all healthy children carried the wild VV genotype, while only 44% of hypospadias cases carried the wild VV genotype and 56% carried the mutant L allele-containing genotype (VL-LL) with high significant p value (p < 0.001). All healthy children carried the wild allele (100%) versus 69% in hypospadias children with the mutant allele presenting only in hypospadias children (31%) with highly significant p value (p < 0.001). Hypospadias children had significantly higher frequency of heterozygous GR genotype than healthy controls with odds ratio equal to 2.759. Mutant R allele was present more in hypospadias cases than in controls with odds ratio equal to 2.539. Mutant R containing genotypes (GR + RR) were more significantly associated with hypospadias with odds ratio equal to 2.897 (Table 2).
Comparison of frequency of the genotypes, alleles, and different models with V89L and G34R polymorphisms in the SRD5A2 gene between groups and after adjustment by mother age, father age, consanguinity, residence and gestational age (Tables 2 and 3). The rs523349 and rs782032018 SNP agreed with Hardy–Weinberg Equilibrium (HWE) (p > 0.05) in all groups. Regarding the SRD5A2 rs523349 genotypes frequencies in different genetic models, dominant, Co-dominant-1, Co-dominant-2, over dominant models showed a significant difference upon comparing cases and controls, while no significant difference in recessive models. While in SRD5A2 rs782032018, dominant, Co-dominant-1, over dominant models showed a significant difference between cases and controls, while no significant difference in recessive and Co-dominant models. Haplotype Association Analysis of SRD5A2 gene polymorphisms (Table 4). There was a significant difference in haplotype frequency between the two studied groups Linkage Disequilibrium Analysis (Table 5). For hypospadias patients, there was a significant linkage disequilibrium between SRD5A2 rs523349 and SRD5A2 rs782032018.
Declaring the association of genotypes and type of hypospadias, the G34R polymorphism showed a significant association with type of hypospadias (p = 0.028), while V89L polymorphism did not show such association (p = 0.607) (Table 6).
Univariate and multivariate logistic regression analysis for the parameters affecting hypospadias cases reported that Binary logistic regression analysis showed that mother age and rural residence were the most independent predictors for hypospadias in the studied population with odds ratio equal to of 1.305 and 4.833, respectively (Table 7).
4 Discussion
Hypospadias phenotypes are categorized into three groups including distal (glanular, coronal and subcoronal), middle, and posterior/proximal hypospadias (penoscrotal, scrotal, perineal), respectively [14]. This study clinically revealed that 38% of children presented with glanular hypospadias, 20% had coronal hypospadias, 18% had penoscrotal, while 14% had subcoronal hypospadias and 10% had midshaft type. This agrees with Fathi et al. [15] who showed that distal hypospadias which includes glanular and coronal is the most common type (60–70%).
Regarding hypospadias risk factors, we found higher maternal and paternal age, consanguinity; rural residence and preterm labor were significantly more in hypospadias group rather than control group. The mean maternal age of hypospadias cases was (30.74 ± 5.18) years versus (25.21 ± 4.15) years in controls and this is found to be statistically significant (p < 0.001). Also, multivariate logistic regression analysis showed that older mother age was an important risk predictor for hypospadias (p = 0.001; OR = 1.305; 95% CI 1.114–1.528). This is similar to what is concluded by Sastre et al. [16] and Fisch et al. [17] that increased maternal age is a risk factor for hypospadias and that the frequency of severe cases was more in children of mothers 35 years or older compared to mothers younger than 20 years. Increased frequency of hypospadias with advanced maternal age may be explained based on that older mothers would probably have longer exposure to endocrine disruptors than younger mothers and thus greater risk of hypospadias [18] or may be explained through the underlying genetic defects that associate with aging [19].
The mean paternal age of hypospadias cases was (35.66 ± 5.62) years versus (32.56 ± 5.37) years in controls (p = 0.007). Despite the difference in mean paternal age between cases and controls, both groups were not considered to have advanced paternal age. Green et al. [20] who revealed an association between advanced paternal age and risk for hypospadias and explained their finding on the basis of increased DNA mutations and chromosomal aberrations in sperm with advanced paternal age, but this was against Sastre et al. [16] who showed lack of association between paternal age and hypospadias.
The percentage of consanguinity in our hypospadias patients is 32% versus 12% in controls (p = 0.016). This is in agreement with Jurat et al. [21] whose study showed that the consanguinity was positive in more than half of his patients. High rates of marriages among blood-relatives are well known in my country and other Islamic countries.
Regarding residence, it was found that 72% of cases were from the rural areas versus 26% in controls (p < 0.001). Also, multivariate logistic regression showed that rural residence was an important risk predictor for hypospadias (p = 0.004; OR = 4.833; 95% CI 1.639–14.250). In another case–control study involving 440 Chinese boys, Huang et al. [22] reported rural residence as a main risk factor predisposing for hypospadias. The most plausible explanation for these finding lies in the fact that mothers in the rural areas are usually engaged in agricultural work which associates with increased exposure to pesticides.
As regard gestational age, our study revealed that there was a statistically significant difference between cases and control, (p = 0.003) but not for birth weight (p = 0.487). On the other hand, Chong et al. [23] concluded that hypospadias is associated with very low birth weight (VLBW) but not with preterm birth. However, Ghirri et al. [24] showed that both preterm birth and birth weight seemed to be risk factors for hypospadias.
A great functional polymorphism of the SRD5A2 gene, V89L, is caused by a G to C transversion that results in the replacement of valine for leucine at codon 89. The leucine type of the enzyme is 30% less effective than valine form (decreased DHT levels) which may contribute to hypospadias [25]. Regarding genetic variants of V89L- SRD5A2 polymorphism, our study revealed that hypospadias children had higher frequency of heterozygous genotype VL and homozygous LL genotype than healthy controls (p < 0.001). Also, mutant L allele was more predominant in the hypospadias children (p < 0.001). This also coincides with Zhang et al. [26] who demonstrated in their study that V89L was a potent determinant of the risk of hypospadias and the risk was further raised in the presence of leucine allele in homozygous form.
Another major functional polymorphism of the SRD5A2 gene, named G34R, which is a point mutation at codon 34 that causes conversion of glycine to arginine leading to decrease in the enzyme activity to less than 5% of its level [27]. G34R mutation also has been reported to decrease the affinity of tissues to testosterone in vitro [28]. Regarding G34R-SRD5A2 distribution in our studied population, hypospadias children had higher frequency of heterozygous GR genotype and homozygous RR genotype than controls (p < 0.031). Also, mutant R allele, as the allele suspected to increase the risk, was more predominant in the hypospadias group with significant difference between cases and control (p = 0.021) (Table 2). Little studies have been done about association of G34R-SRD5A2 gene polymorphism with hypospadias including Akcay et al. [29] who reported that this mutation was related to severe hypospadias.
In our study, the G34R polymorphism showed a significant association with type of hypospadias, while V89L polymorphism did not show association with the type of hypospadias. Thai et al. [30] stated that SRD5A2 gene mutations are usually found only in severe cases of hypospadias not the more common and less severe variants of glandular or penile forms and they attributed the correlation between phenotype and genotype to the degree of impairment of enzyme function and reduction of the affinity of testosterone so, a stricter approach have advocated for evaluation for differences in sex development (DSD) in all proximal hypospadias associated with micropenis or undescended testes [31].
Table 7 reveals that older age of parents, positive consanguinity, rural residence, preterm delivery and G34R polymorphism of the SRD5A2 gene are strong determinants of the risk of hypospadias among children by univariate analysis. After control of confounding variables, multivariate logistic regression revealed that mother age and rural residence were the most important independent risk predictors of hypospadias so; these factors should be considered when counseling patients and advising about the most important risk factors to avoid.
Hypospadias is an important health problem and can be a significant burden on health care supplies so, it is important to increase the awareness of the community about the risk factors that may lead to the development of hypospadias.
Overall, the study including evaluation of risk factors, study of genetic background and so ability to offer genetic counseling for patients and their families is very important issue to be more extensively studied. Finally, we have some limitations in our study; first, the sample size of our research population did not allow us to differentiate effects of weak or rare risk factors. Larger studies could assist the identification of these risk factors and reserve opportunities for the further in depth investigation of the associations found to date. Second, we did not assess the androgen receptor level so; correlation between androgen receptor level and our results did not evaluate and these is recommended in future studies. Third, the results of genetic polymorphism cannot be generalized over countries due to racial differences and lack of multicenter study.
5 Conclusions
V89L and G34R Steroid 5 alpha reductase type 2 gene polymorphisms, higher maternal and paternal age, consanguinity, rural residence and preterm labor carry significant risk factors for hypospadias. On multivariate logistic regression, mother age and rural residence are the most independent predictors for hypospadias.
Availability of data and materials
All data generated or analyzed during this study are included in this article. Further enquires can be directed to the corresponding author.
Abbreviations
- AS-PCR:
-
Allele-specific polymerase chain reaction
- BLAST:
-
Basic Local Alignment Search Tool
- DHT:
-
Dihydrotestosterone
- DNA:
-
Deoxyribonucleic acid
- DSD:
-
Differences in sex development
- GR:
-
Glycine to arginine
- PCR:
-
Polymerase chain reaction
- SRD5A2:
-
Steroid 5α-reductase type 2
- VLBW:
-
Very low birth weight
- VV:
-
Wild valine residue genotype
- V89L:
-
Valine to leucine change in codon 89
References
van der Horst HJ, de Wall LL (2017) Hypospadias, all there is to know. Eur J Pediatr 176(4):435–441
Singh N et al (2018) Single-nucleotide and copy-number variance related to severity of hypospadias. Pediatr Surg Int 34(9):991–1008
Joodi M et al (2019) The genetic factors contributing to hypospadias and their clinical utility in its diagnosis. J Cell Physiol 234(5):5519–5523
Arpino C et al (2000) Teratogenic effects of antiepileptic drugs: use of an International Database on Malformations and Drug Exposure (MADRE). Epilepsia 41(11):1436–1443
Caton AR et al (2008) Maternal hypertension, antihypertensive medication use, and the risk of severe hypospadias. Birth Defects Res A Clin Mol Teratol 82(1):34–40
Aberg A, Westbom L, Kallen B (2001) Congenital malformations among infants whose mothers had gestational diabetes or preexisting diabetes. Early Hum Dev 61(2):85–95
Balaji DR et al (2020) Androgen Receptor Expression in Hypospadias. J Indian Assoc Pediatr Surg 25(1):6–9
Kon M et al (2015) Molecular basis of non-syndromic hypospadias: systematic mutation screening and genome-wide copy-number analysis of 62 patients. Hum Reprod 30(3):499–506
Di Marco C et al (2013) Ambiguous external genitalia due to defect of 5-alpha-reductase in seven Iraqi patients: prevalence of a novel mutation. Gene 526(2):490–493
Bouty A et al (2015) The genetic and environmental factors underlying hypospadias. Sex Dev 9(5):239–259
Ha SJ et al (2003) Analysis of genetic polymorphisms of steroid 5alpha-reductase type 1 and 2 genes in Korean men with androgenetic alopecia. J Dermatol Sci 31(2):135–141
Kranaster R, Marx A (2007) Increased single-nucleotide discrimination in allele-specific polymerase chain reactions through primer probes bearing nucleobase and 2’-deoxyribose modifications. Chemistry 13(21):6115–6122
Gad YZ et al (2007) Detection of the G34R mutation in the 5 alpha reductase 2 gene by allele specific PCR and its linkage to the 89L allele among Egyptian cases. Sex Dev 1(5):293–296
Sheldon CA, Duckett JW (1987) Hypospadias. Pediatr Clin N Am 34(5):1259–1272
Fathi BA et al (2023) Urethral advancement and glanuloplasty versus tubularized incised plate urethroplasty for distal hypospadias repair: a prospective randomized study. BMC Urol 23(1):70
Estors Sastre B et al (2019) Occupational exposure to endocrine-disrupting chemicals and other parental risk factors in hypospadias and cryptorchidism development: a case-control study. J Pediatr Urol 15(5):520e1-520e8
Fisch H et al (2001) Maternal age as a risk factor for hypospadias. J Urol 165(3):934–936
Fernandez MF et al (2007) Human exposure to endocrine-disrupting chemicals and prenatal risk factors for cryptorchidism and hypospadias: a nested case-control study. Environ Health Perspect 115(Suppl 1):8–14
Hook EB (1981) Rates of chromosome abnormalities at different maternal ages. Obstet Gynecol 58(3):282–285
Green RF et al (2010) Association of paternal age and risk for major congenital anomalies from the National Birth Defects Prevention Study, 1997 to 2004. Ann Epidemiol 20(3):241–249
Jurat R, Rahimi MT, Barolia R (2021) Surgical outcomes and socio-demographic pattern of hypospadias patients treated in a tertiary care center in Kabul, Afghanistan. J Pediatr Urol 17(5):674e1-674e7
Huang Y et al (2017) Risk factors for different types of hypospadias. Zhonghua Nan Ke Xue 23(5):441–447
Chong JH et al (2006) Factors associated with hypospadias in Asian newborn babies. J Perinat Med 34(6):497–500
Ghirri P et al (2009) Prevalence of hypospadias in Italy according to severity, gestational age and birthweight: an epidemiological study. Ital J Pediatr 35:18
Samtani R et al (2011) Hypospadias risk and polymorphism in SRD5A2 and CYP17 genes: case-control study among Indian children. J Urol 185(6):2334–2339
Zhang K et al (2017) Steroid 5-alpha-reductase type 2 (SRD5A2) gene V89L polymorphism and hypospadias risk: a meta-analysis. J Pediatr Urol 13(6):630e1-630e9
Han B et al (2020) Genetic analysis of 25 patients with 5 alpha-reductase deficiency in chinese population. Biomed Res Int 2020:1789514
Sahu R et al (2009) Genetic analysis of the SRD5A2 gene in Indian patients with 5alpha-reductase deficiency. J Pediatr Endocrinol Metab 22(3):247–254
Akcay T et al (2014) AR and SRD5A2 gene mutations in a series of 51 Turkish 46, XY DSD children with a clinical diagnosis of androgen insensitivity. Andrology 2(4):572–578
Thai HT et al (2005) The valine allele of the V89L polymorphism in the 5-alpha-reductase gene confers a reduced risk for hypospadias. J Clin Endocrinol Metab 90(12):6695–6698
Wong YS et al (2018) Incidence and diagnoses of disorders of sex development in proximal hypospadias. J Pediatr Surg 53(12):2498–2501
Acknowledgements
Not applicable.
Funding
This research received no external funding.
Author information
Authors and Affiliations
Contributions
WM analyzes the data. SA gave the final approval of this manuscript. MT helped in protocol development. MA collect the data. FZ wrote the manuscript and performed the surgical repair.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
The study was approved by Menoufia University—Faculty of medicine ethics committee with number 7/2020 PED114. The study was performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. An informed written consent obtained from all enrolled children family prior to the study.
Consent for publication
The study protocol was approved by our local ethical committee. Written informed consent was obtained from the children family for publication and any accompanying images.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Moustafa, W., Abouelella, S., Tawfik, M. et al. Genetic and other epidemiological risk factors of infants and children with hypospadias: a case control study. Afr J Urol 29, 55 (2023). https://doi.org/10.1186/s12301-023-00386-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12301-023-00386-y