Role of circular RNAs (CircANXA2 and CircFBXW7) in bladder cancer

Abstract

Background

The most prevalent malignancy in the urinary tract is bladder cancer, which is becoming more commonplace globally. Circular RNAs, or circRNAs, have a role in cancer pathogenesis as they can be used as biomarkers to help identify new cases and predict the likelihood of recurrence. The current work examined the gene expression of CircANXA2 and CircFBXW7 and evaluated their potential utility in bladder cancer diagnosis.

Subjects and methodology

Seventy people with benign urologic diseases, seventy people with bladder cancer, and seventy healthy controls participated in the study. The polymerase chain reaction in real time quantified the gene expressions of CircANXA2 and CircFBXW7.

Results

Compared to the benign group and controls, bladder cancer patients had significantly greater levels of CircANXA2 expression (p < 0.001). In contrast to the benign group and controls, bladder cancer patients had significantly decreased levels of CircFBXW7 expression (p < 0.001). CircANXA2 and CircFBXW7 have comparable sensitivity and specificity; CircANXA2 had sensitivity, and specificity (77.14% and 76.43) and CircFBXW7 had sensitivity, and specificity (80.0% and 70.0%) respectively in detecting bladder cancer. CircANXA2 and CircFBXW7 were found to be the risk variables for bladder cancer using multivariate analysis. The odds ratios (OR) for CircANXA2 and CircFBXW7 were 1.240 (1.135–1.354) and 0.026 (0.006–0.107), in that order. In conclusion, CircANXA2 and CircFBXW7 may be highly specific and sensitive diagnostic markers for bladder cancer.

1 Background

For those over 65 years, bladder cancer is one of the greatest prevalent cancers. In the world, it is the eighth most common type for females and the fourth most common for males to develop malignant tumors [4]. If left untreated, bladder cancer is a deadly and complicated illness that often results in complications [17]. Successful outcome requires early detection, skilled therapy, and continued supervision. Urothelial carcinoma is the greatest common subtype of bladder cancer, whereas there are a few others as well, such as squamous, small cell, and adenocarcinomas [18]. The prognosis for bladder cancer cases is usually bad. Even though the majority of instances are detected early, Amin et al. [1] showed that 15–20% of cases result in muscle-invasive illnesses, and about 50% of patients recover following therapy. Despite being invasive, expensive, and hazardous due to hematuria or a urinary tract infection (UTI), cystoscopy is the main method for diagnosing and monitoring bladder cancer [8]. The urine cytology examination provides improved sensitivity and specificity for detecting high-grade cancer. Malignant cells exfoliated are detected under the microscope during this non-invasive procedure. Its sensitivity range for diagnosing low-grade tumors is poor. Due to the high rate of false positives and other factors, finding a substitute blood marker for the current diagnostic method [13]. Endogenous non-coding RNAs known as circular RNAs (circRNAs) are extensively distributed in eukaryotic cells and have gained great attention recently. To make them, a circular structure is formed via the connection of the 5′ cap and 3′ poly (A) tail. This structure is then created by exon/intron cyclization. Since they are in the cytosol or preserved in exosomes, they are expressed stably and can resist RNA exonuclease damage. Exosomes have a lipid bilayer membrane structure, which can protect nucleic acids from degradation by extracellular RNases. The molecular composition of exosomes is stable and tissue-specific, which can reflect the state of the tissue of origin. And this stability makes them potentially useful as biomarkers [10]. Circular RNAs are miscellaneous and have distinct biological activities as a result of various mechanisms. For instance, circRNAs sponge miRNA, attach to functional proteins, translate into proteins, manage RNA splice, and control transcription [28]. Previous studies have demonstrated that circRNAs significantly influence cancer course by altering features associated with the disease such as proliferative signaling, growth suppressor evasion, loss of differentiation signals, and tumor-related effects [3]. According to Liang et al. [12], circRNAs are novel molecules that might be the basis of various diseases and cancers. In this research, the gene expression of circular F-box and WD repeated domain holding 7 (CircFBXW7) and Annexin A2 (CircANXA2) in Egyptian bladder cancer patients was investigated. We examined their possible connections with clinicopathological information to elucidate their diagnostic relevance.

2 Subjects and methodology

2.1 Subjects

This study was performed at the Medical Biochemistry Department of the Faculty of Medicine from April 2022 to October 2023. The cases were carefully chosen from the University Hospitals’ patient health center run by the Department of Oncology and Nuclear Medicine. A total of 210 individuals, including 128 men and 82 women, registered for the present study. The subjects were divided as follows. 70 patients with bladder cancer made up Group I. Group II: 70 subjects had urinary tract infections or urethral stricture. Group III consisted of seventy healthy controls who were of a similar age and gender. Each participant wrote their consent, and the study was accepted by the regional ethical team following the Declaration of Helsinki. Any gender, age between 30 and 72, normal liver and renal function, any stage of cancer for the patient group, the diagnosis of bladder carcinomas of any histopathological subtype, and all Eastern Cooperative Oncology Group performance statuses were eligibility prerequisites [16]. Patients with neurological, cardiovascular, or other types of cancer were omitted from the study. Each participant underwent a whole blood count, evaluation of hepatic and renal functions, history taking, a thorough physical examination, analysis of urine, and real-time PCR for assessing the circular RNA expression (CircANXA2 and CircFBXW7). Based on the clinical justification, staging workups for patients with bladder carcinomas were performed using CT scans of the chest, abdomen, pelvis, and bones or PET/CT scans. The pathological diagnosis was reached during cystoscopic biopsy or surgery. The TNM of the American Joint Committee of Carcinomas was utilized for staging the illness [2].

2.2 Sample collection and preparation

7 ml blood was obtained sterilely via venipuncture and classified as follows. Blood was drawn in the following ways. On a Beckmann AU 680 autoanalyzer (Beckmann, USA), 3 ml was placed in a tube for measurement of liver transaminases, urea, and serum creatinine; 2 ml was placed in an EDTA vacutainer to keep whole blood for RNA extraction step; and 2 ml was given for CBC on a Sysmex XN-1000 Hematology Analyzer. The plasma was isolated, and then it was frozen at – 80 °C. Meanwhile, qRT-PCR was utilized for quantification of CircANXA2 and CircFBXW7. Each subject also had 5 ml of urine taken in the early morning for examination for the presence of hematuria.

2.3 Genetic analysis

The miRNeasy kit (Qiagen, USA) was utilized for extracting the RNA. The amount of RNA was calculated using a Nano-Drop 2000 instrument from Thermo Scientific (USA) at wavelengths 260 and 280 nm. Then, reverse transcription was carried out in a volume of 20 μl with 10 μl of RNA. This contained 2 μl of 10 Reverse Transcription buffer, 2 μl of 10 Reverse Transcription hexamer primers, 0.8 μl of 25 deoxy Nucleotides triphosphate mix, 1 μl of RNase enzyme inactivator, 1 μl of reverse transcriptase, and 3.2 μl of nuclease-free H₂O. A high-capacity cDNA RT kit (Applied Biosystems, USA) was then utilized for the reverse transcription, which took place for 1 h at 37 °C and 5 min at 95 °C, and then it was continued at 4 °C. qRT-PCR evaluated the expression levels of circular RNA (CircAXA2 and CircFBXW7): CircANXA2 (F) primer: 5′ CGTTTCCGACACATCTGGC3′ and CircANXA2 (R) primer: 5′ CCCTGGCATCCTGGTCAAT 3′; CircFBXW7 (F) primer: 5′GTCTCCCAAACCTGACTGTC 3′ and CircFBXW7 (R) primer: 5′ GTTGGTTCCCTTCCTCCTTC 3′. The housekeeping GAPDH gene was used as the endogenous control: GAPDH (F) primer: 5′CTCTGCTCCTCCTGTTCGAC3′ and GAPDH (R) primer: 5′ TTAAAAGCAGCCCTGGTGAC 3′. By deducting the CT values for GAPDH from the CT values for the circular RNA under study, qRT-PCR was utilized to quantify the circular RNA. 500 ng and 10 μl of the qRT-PCR product (cDNA template) were added to the PCR Master Mix. 20 μl was the ultimate volume. The cycle number is required for the reporter signal to interrupt the threshold determines the PCR cycle threshold. By deducting the CT values for GAPDH from the CT values for the circular RNA, the PCR cycle threshold was found (see Fig. 1). 15 min were spent on a 95 °C cycle. 50 cycles were used. 30-s cycles were used at 60 °C. Nuclease-free H2O (6 μl) was utilized. For SYBR Green I, 3 μl of NTP mix (including dUTP) was used. MgCl2 was dissolved in 5 μl for ROX. The efficiency of the PCR reaction was validated, all the experimental conditions were well-controlled, the same efficiency was assumed for both the target and housekeeping genes. Lower circular RNA was correlated with higher Ct values. The 2^−ΔΔCt formulation [14] was utilized for calculating the relative quantification values for each unique circular RNA as follows:

Fig. 1

A Amplification plot for CircANXA2 gene expression (normalized fluorescence signal (ΔRn) plotted versus cycle number). B Amplification plot for CircFBXW7 gene expression (normalized fluorescence signal (ΔRn) plotted versus cycle number). C Melting curve for CircANXA2 gene expression. D Amplification plot for CircFBXW7 gene expression

Gene expression (Relative Quantification) RQ = 2–ΔΔCt
ΔΔCt =	ΔCt Case−ΔCt Control
ΔCt Patient =	Ct (target gene)−Ct (GAPDH gene)
ΔCt Control =	Ct (target gene)−Ct (GAPDH gene)

2.4 Statistical methods

IBM Computer software Pack Type 20.0 (IBM Corp.) was utilized to examine the data after they were entered into the computer. Numbers and percentages were utilized to define the quantitative data. The Kolmogorov test confirmed the circulation's normality. The range, mean, median and interquartile range were utilized to characterize the measurable data. The results' significance was assessed at a level of 5%. The following tests were utilized. The Chi-square test was used to compare the two groups. Fisher's exact test was used for comparison between two groups larger than 20%. Logistic analysis was conducted to evaluate the odds ratio and 95% confidence intervals (CI). One-way ANOVA was utilized for comparisons involving more than 2 groups. The Kruskal–Wallis test for pairwise, Dunn's Multiple Comparisons (Post Hoc), the ROC curve for specificity and sensitivity, and the AUC (area under the curve) were also utilized.

3 Results

The demographic information is presented in Table 1, where non-significant variations in age and gender between the 3 investigated groups are indicative of matched groupings. Table 2 demonstrates a significant variation between group I in comparison to group II and III as regards smoking, family history, bilharziasis, hydronephrosis, gross hematuria, and irritative symptoms. Group I had a significantly higher level of microscopic hematuria, serum creatinine, urea, ALT, and AST (p < 0.001) (Table 3). The distribution of parameters and characteristics of bladder cancer patients are described in Table 4. In the comparison of Group I to Groups II and III, CircANXA2 expression was considerably higher in Group I (p < 0.001) (Fig. 2A). CircFBXW7 expression, on the other hand, was noticeably lower in Group I when compared to Groups II and III (p < 0.001) (Fig. 2B). Furthermore, CircFBXW7 expression had a significant correlation with nodal status (p < 0.05). While, CircANXA2 expression demonstrated a significant relation with tumor stage, nodal status, and grade (p < 0.05) (Table 5). The cutoff number for CircANXA2 was > 7.8, with 74.29% sensitivity, 67.14% specificity, 69.3% PPV, 72.3% NPV, 95% confidence interval, and 0.77 AUC for identifying bladder cancer from benign urinary diseases. With an 80.0% sensitivity, 78.57% specificity, 78.9% PPV, 79.7% NPV, 95% confidence interval, and 0.80 AUC, the threshold value for CircFBXW7 was 0.7 for identifying bladder cancer from benign urinary diseases (Fig. 3). The cutoff value for CircANXA2 was > 5.7, with 77.14% sensitivity, 76.4% specificity, 62.1% PPV, 87% NPV, 95% confidence interval, and 0.858 AUC for diagnosing bladder cancer in non-cancer individuals (Groups II and III). The cutoff value for CircFBXW7 was 0.8, with 80% sensitivity, 70% specificity, 57% PPV, 87.5% NPV, 95% confidence interval, and 0.829 AUC for diagnosing bladder cancer from non-cancer patients (Fig. 3). According to a multivariate logistic regression analysis, CircANXA2 and CircFBXW7 could both be viewed as risk factors for the occurrence of bladder cancer. In a univariate analysis, bladder cancer development was linked to smoking, irritable symptoms, CircANXA2 overexpression, and CircFBXW7 downregulation. A multivariate study revealed that the development of bladder cancer was associated with smoking, overexpression of circANXA2, and subsequent downregulation of circFBxW7 (Table 6).

Table 1 Comparison between the three studied groups according to demographic data

Table 2 Comparison between the three studied groups according to history and clinical presentation

Table 3 Comparison between the three studied groups according to Laboratory investigation

Table 4 Distribution of parameters and baseline characteristics of bladder cancer patients (n = 70)

Fig. 2

A Comparison between the three studied groups according to CircANXA2. B Comparison between the three studied groups according to CircFBXW7

Table 5 Relation between CircANXA2, CircFBXW7 and clinical finding in Bladder cancer patients (n = 70)

Fig. 3

A ROC curve for CircFBXW7 and CircANXA2 to discriminate bladder cancer patients (n = 70) from control (n = 70). B ROC curve for CircFBXW7 and CircANXA2 to discriminate patients with benign urinary disorders (n = 70) from control (n = 70). C ROC curve for CircFBXW7 and CircANXA2 to discriminate bladder cancer patients (n = 70) from patients with benign urinary disorders (n = 70). D ROC curve for CircFBXW7 and CircANXA2 to discriminate bladder cancer patients (n = 70) from non-cancer groups (n = 140)

Table 6 Univariate and multivariate logistic regression analyses for the parameters affecting bladder cancer patients (n = 70) from non-cancer (n = 140)

4 Discussion

Circular RNAs (circRNAs) control the processing of pri-miRNA, translation, protein degradation, transcription, and splicing in human malignancies. They also act as protein scaffolds, protein recruiters, protein enhancers, miRNA/protein sponges, templates for translation, and enhancers of protein function [24].

CircRNAs sponge miRNAs preventing them from adhering to their target mRNAs, thus disrupting the inhibitory effect of miRNAs on protein expression [23]. Furthermore, circRNAs act as tumor suppressors or oncogenes to support the growth of several malignancies, and they could 1 day be used as innovative diagnostic and prognostic indicators [20]. It has been demonstrated that circRNA expression and function differ significantly across different cancers [7]. According to a recent preliminary study, circRNAs play a central part in the neoplasms' formation and progress, including tumorigenesis [20]. Therefore, we performed the present study to assess the role of circRNA (ANXA2 and FBWX7) as diagnostic biomarkers for bladder cancer. In a present prospective study, we included 70 patients with BC who were admitted to the Department of Clinical Oncology and Nuclear Medicine in Menoufia University Hospital from the period (April 2022 To October 2023) and another 70 Patients with severe urocystitis along with 70 healthy persons who had no previous history of BC or urocystitis were enrolled. We measured the level of CicrRNA (ANXA2 and FBWX7) in the plasma of patients suffering from BC (RT-time PCR).

CircRNAs, like the majority of non-coding RNA, predominantly control genetic expression in several ways. Sponging, which prevents miRNA activity, is one of the most extensively researched methods. By sequencing complementary sequences that prevent miRNAs from adhering to the appropriate mRNAs (sponging), they disrupt the inhibitory effect of miRNAs on protein expression, adding an extra layer of regulation to gene expression. The competing endogenous RNA in this case is referred to as the circRNA/miRNA/mRNA axis [19]. CircRNAs could also control gene expression by acting as a splice variant of the parent gene, competing with each other for the same translatable mRNA. Some authors refer to this process as an “mRNA trap” as the parent gene’s RNA is stuck in a circular non-translatable form [9].

When compared to controls, bladder cancer patients had significantly higher levels of CircANAX2 in comparison with healthy individuals. CircANXA2, with an AUC of 0.858, significantly distinguished bladder cancer patients from healthy subjects when the ROC curve was plotted (p > 0.001). According to Huang et al. [6],

CircANXA2 augments the transcription of its parental oncogene ANXA2, which induces fibrinolysis and tumor cell infiltration and restricts the sensitivity of tumor cells to chemotherapy, and overexpression of it will increase bladder carcinoma risk. ANXA2 is a Ca +  + -dependent phospholipid-binding protein, which has been implicated in many malignant processes. The N-terminal domain of AnxA2 contains binding sites for interaction with p11 (S100A10) and tissue plasminogen activator (t-PA), while the C-terminal end mediates binding to calcium, phospholipids, and actin filaments. The product of the CircANXA2 gene, is involved in endocytosis, exocytosis, motility, fibrinolysis, linkage to the F-actin cytoskeleton, and ion channel formation. Several studies have shown that the AnxA2 expression is correlated with high tumor grade and stage and poor survival of cancer patients. Therefore, this protein has been an attractive investigative target to evaluate its role in bladder cancer diagnosis and management [5].

Ju et al. [11] used the bioinformatics analysis method, the results showed that circANXA2 may bind to miR-33a-5p. To further verify the relationship between circANXA2 and miR-33a-5p, they constructed a dual luciferase reporter gene detection system. circANXA2 regulates the transcription of the miR-33a-5p downstream target gene. The 3-phosphoinositide-dependent kinase 1 (PDPK1) and affects the malignant progression of cancer.

PDPK1 structure is composed of a 63 kDa serine/threonine (Ser/Thr) protease. PDPK1 is an upstream-activated kinase of Akt1. The C-terminal pH region is compatible with phosphatidylinostol-3,4,5,-triphosphate (Pi2P3) and the phosphorylates Akt/PKB. The Pi2P3-dependent protein kinase PDPK1 binds to Pi2P3 through its pH domain in the cytoplasm, causing conformational changes in Akt and PDPK1 to be close to each other. PDPK1-mediated PI3K/Akt signaling is associated with many types of cancers [22].

Our findings aligned with those of Ju et al. [11], who discovered that pulmonary cancer cell lines and tissues exhibited high levels of circulating antigen (CircANXA2) expression. Lung cancer cell clonogenesis and proliferation are both decreased by CircANXA2 inhibition. Apoptosis is also triggered by the knockdown of circANXA2. Furthermore, CircANXA2 regulates downstream the 3-phosphoinositide-dependent kinase (PDPK1) expression by regulating miRNAs, which in turn regulates the malignant activity of lung cancer cells by directly inhibiting miRNA activity. CircANXA2 controls lung cancer progression by modifying the transcription of miRNAs linked to the downstream target gene PDPK1.

CircANXA2 expression is elevated in acute myeloid leukemia patients, as demonstrated by Tayel et al. [20], and it functions as a nucleotide sponge to inhibit the action of the chemo-sensitizing enzymes miR-23 a-5p, miR-503 a-3p, and cancer stem cell proliferation inhibitors.

In addition, Zong and Wang [30] found that CircANXA2 overexpression decreased glutathione activity while increasing lactate dehydrogenase enzyme and oxidative stress markers (malondialdehyde, superoxide dismutase). Western blot analysis revealed that pro-apoptosis genes (Bax) and cytochrome (C) are overexpressed while anti-apoptosis genes (Bcl-2) are under-expressed due to the CircANXA2 overexpression. CircANXA2 may be a target for cardiac ischemia–reperfusion injury because upregulating miR-133 can promote apoptosis and reverse the reduction of spread mediated by CircANXA2 overexpression (AUC = 0.828).

On the other hand, our results revealed that circFBXW7 was markedly downregulated in bladder cancer patients. The ROC curve demonstrates the significant difference between bladder cancer patients and non-cancer patients. This is consistent with Yang et al.’s [26] research, which stated that circFBXW7 is involved in the coding of a novel protein into gliomas, and circFBXW7 has been shown to have tumor suppressor activity.

Similar findings were made by Zhu et al. [29], who discovered that non-small carcinoma of the lung cells expressed circFBXW7 at a lower level than healthy human pulmonary BEAS-2B cells. Cell invasion, migration, and proliferation were all inhibited by circFBXW7 overexpression. Moreover, the target of circFBXW7 was determined to be miR-492 based on the circFBXW7-miRNA network and qRT-PCR justification. MiR-492 mimics overrode the inhibitory effect of circFBXW7 overexpression on cell invasion, migration, and proliferation. Depletion of circFBXW7 led to an increase in cell proliferative capacity, so circFBXW7 is suggested to act as a tumor suppressor gene, hence its downregulation will increase bladder carcinoma risk. FBXW7, the gene product of CircFBXW7, is a member of the F-box protein family, FBXW7 serves a role in phosphorylation-dependent ubiquitination and proteasome degradation of oncoproteins that play a critical role(s) in oncogenesis. It affects many regulatory functions involved in cell survival, cell proliferation, tumor invasion, DNA damage repair, genomic instability, and telomere biology. FBXW7 is frequently inactivated in human cancers through genetic and epigenetic mechanisms, along with post-transcriptional modifications. Subsequently, the inactivation of FBXW7 is a major cause of carcinogenesis and the development of human cancers.

Potential miRNAs of circFBXW7 were predicted through miRanda software and miTarBase database, and Cytoscape software was performed to plot the circRNA–miRNA regulatory network. CircFBXW7 Reduced Cell Proliferation, Migration, and Invasion through Binding to miR-492. The expression of miR-492 was repressed when circFBXW7 was overexpressed and vice versa [29].

Examination of FBXW7 protein expression by immunostaining shows that compared with normal primary tissues, FBXW7 protein expression is greatly reduced in urothelial cancer [21].

Moreover, Luo, et al. [15] concluded that circFBXW7 overexpression inhibited the pathogenesis of T-cell acute lymphoblastic leukemia through the mediation of the miR-494-3p/SOX1 axis.

In addition, CircFBXW7 is under-expressed in TNBC cell lines as determined by qRT-PCR, and low expression is linked to unfavorable clinical outcomes, according to Ye et al. [27]. In contrast to TNBC prognostic factors, CircFBXW7 expression was in relative correlation with the size of the tumor and lymph nodal metastasis. Via upregulating miR-197 3p and FBXW7, the FBXW7-185aa protein coded by circFBXW7 suppresses the development of TNBC. Consequently, CircFBXW7 may be utilized in TNBC as both a therapeutic goal and a prognostic marker.

Last but not least, circRNA is a crucial component of the network of ncRNAs, which is a crucial regulator of several cancers. CircRNAs are crucial in the progress of anti-cancer treatment resistance. The clinical potential of circRNAs will be further developed by recent studies of circRNAs covering a wide range of therapeutic areas, from conventional chemotherapy drugs to novel target and immunotherapy drugs [25]. These studies will also provide a new research focus.

5 Conclusion

It was determined that circRNAs (CircANXA2 and CircFBXW7) may be useful, sensitive and specific non-invasive tumor biomarkers for bladder cancer. In addition, since CircANXA2 has a stronger correlation with tumor grading, staging, and nodal staging compared to CircFBXW7, which was only correlated with lymph node staging, it may be able to predict how the disease will progress. However, to confirm our findings, we must conduct additional research on a larger sample size including multicenter, and perform a functional study to elucidate the role of circular RNA in cancer bladder pathogenesis exploring the potential interactions between circANXA2, circFBXW7, and other molecular players.

Study Limitations: The single-centered ethnicity and the fairly small sample size. Also lack of functional studies to elucidate the role of circular RNA in cancer bladder pathogenesis. Moreover, longitudinal studies are needed to evaluate the prognostic potential of circANXA2 and circFBXW7 in predicting disease progression, recurrence, and response to treatment. Furthermore, an investigation of the potential utility of circANXA2 and circFBXW7 as therapeutic and prognostic targets or in combination with existing therapies for bladder cancer is required.