Skip to main content

Table 1 Genes primers and corresponding annealing temperatures for MSP

From: Exploring urine sediments as a non-invasive method for DNA methylation detection in bladder cancer

Gene   Forward (5’ – > 3’) Reverse (5’ – > 3’) Product size (pb) Tm (°C)
TWIST1 M CCGTCGCCTTCCTCCGACGA TGCGTTAGGGTTCGGGGGCGT 100 64
U TTGGATGGGGTTGTTATTGT CCTAACCCAAACAACCAACC 79 63
hTERT M GAGGTATTTCGGGAGGTTTCGC ACTCCGAACACCACGAATACCG 121 58
U GGGAGGTATTTTGGGAGGTTTTGT’ CAAACTCCAAACACCACAAATACCA 126 58
NID2 M TAGTATTGGTAACGACGATAGTATC AAATTCGAAACTAACGCGACACG 141 58
U TAGTATTGGTAATGATGATAGTATT AAATTCAAAACTAACACAACACA 141 55
VIM M TTATAAAAATAGCGTTTTCGGC ATAACGCGAACTAACTCCCG 143 59
U GGGTTATAAAAATAGTGTTTTTGGT ACAATAACACAAACTAACTCCCA 149 57